Login Register Cart 0
Generic placeholder image

Micro and Nanosystems

Editor-in-Chief

ISSN (Print): 1876-4029
ISSN (Online): 1876-4037

Back
Journal Home About Journal Editorial Board Journal Insight Current Issue Volumes/Issues
Subscribe
Research Article

Aptasensing Ampicillin on Silica Substrate Gapped by Interdigitated Aluminium Electrode

Author(s): Syazwan Paraja, Subash C.B. Gopinath* and M.K. Md Arshad

Volume 11, Issue 2, 2019

Page: [115 - 122] Pages: 8

DOI: 10.2174/1876402911666190404151857

Abstract

Background: Ampicillin has been widely used as a broad-spectrum antibiotic for the treatment and prevention of human diseases with a low-toxicity. Ampicillin plays an important role in therapeutics, however, there might be some synthetically prepared compounds for the applications in agriculture, animals and even humans that eventually have resulted in major health issues.

Objective: This research demonstrates the approach to improve the specific in vitro detection of ampicillin using titanium dioxide nanoparticle-based interdigitated device electrode.

Methods: The fabrication of biosensor was performed using the conventional photolithography integrated process of an inductively-coupled plasma dry-etching. Surface modifications were applied on a 50 µm gapped interdigitated comb-like titanium dioxide nanoparticle modified electrode surface using 0.02 M of 3-Aminopropyl trimethoxysilane, which was diluted in 75% ethanol. A Schiff-base reaction using glutaraldehyde was followed to covalently immobilize streptavidin followed by a non-covalent immobilization of biotinylated-aptamer DNA probe (1 µM), having a sequence of 5’- CACGGCATGGTGGGCGTCGTG–biotin-3’.

Results: These surface modifications with multiple self-assembling monolayers afford the additional control for stability. The immobilized aptamer DNA probe was interacted with the target, ampicillin at 10 mg/ml, resulting in the current field changes across the device. I-V relationship interpreted the selective binding of ampicillin and distinguished kanamycin from carbenicillin. Our sensing system was able to detect ampicillin in a linear range of 0.1 ng until 10 mg/ml with the limit of detection at 0.1 ng/ml.

Conclusion: This sensing platform aimed to evaluate the purity of ampicillin, a promising beneficial approach towards the pharmaceutical industries.

Keywords: Ampicillin, aptamer, interdigitated electrode, titanium dioxide, silica substrate, interdigited device electrode.

« Previous Next »
Graphical Abstract

[1]
Wang, C.; Lakshmipriya, T.; Gopinath, S.C.B. Amine-aldehyde chemical conjugation on a potassium hydroxide-treated polystyrene ELISA Surface for nanosensing an HIV-P24 antigen. Nanoscale Res. Lett., 2019, 14(1), 21.
[2]
Liu, F.; Zhang, Y.; Wang, H.; Zhang, S. Novel conjugated polymers prepared by direct (hetero) arylation: An eco-friendly tool for organic electronics. Molecules, 2018, 23(2), 408.
[3]
Pilolli, R.; Monaci, L.; Visconti, A. Advances in biosensor development based on integrating nanotechnology and applied to food-allergen management. Trends Analyt. Chem., 2013, 47, 12-26.
[4]
Rai, V.; Acharya, S.; Dey, N. Implications of nanobiosensors in agriculture. J. Biomater. Nanobiotechnol., 2012, 3(2A), 315.
[5]
Taniselass, S.; Md Arshad, M.K.; Gopinath, S.C.B. Current state of green reduction strategies: Solution-processed reduced graphene oxide for healthcare biodetection. Mater. Sci. Eng. C, 2018, 96, 904-914.
[6]
Wang, F.; Lakshmipriya, T.; Gopinath, S.C.B. Red spectral shift in sensitive colorimetric detection of tuberculosis by ESAT-6 antigen-antibody complex: A new strategy with gold nanoparticle. Nanoscale Res. Lett., 2018, 13(1), 331.
[7]
Indah, T.P. Determination of functional head and tail groups of Self-Assembled Monolayer (SAM) formed by 2-mercaptoacetate on aluminium oxide substrate. Int. J. Nanoelectr. Mater., 2018, 11, 115-122.
[8]
Sumitha, S.; Vasanthi, S.; Shalini, S.; Chinni, S.V.; Gopinath, S.C.B.; Anbu, P.; Bahari, M.B.; Harish, R.; Kathiresan, S.; Ravichandran, V. Phyto-mediated photo catalysed green synthesis of silver nanoparticles using durio zibethinus seed extract: Antimicrobial and cytotoxic activity and photocatalytic applications. Molecules, 2018, 23(12), 3311.
[9]
Kato, Y.; Minakawa, N.; Komatsu, Y.; Kamiya, H.; Ogawa, N.; Harashima, H.; Matsuda, A. New NTP analogs: The synthesis of 4′-ThioUTP and 4′-ThioCTP and their utility for SELEX. Nucleic Acids Res., 2005, 33(9), 2942-2951.
[10]
Edwards, K.A.; Wang, Y.; Baeumner, A.J. Aptamer sandwich assays: Human α-thrombin detection using liposome enhancement. Anal. Bioanal. Chem., 2010, 398(6), 2645-2654.
[11]
You, M.; Chen, Y.; Peng, L.; Han, D.; Yin, B.; Ye, B.; Tan, W. Engineering DNA aptamers for novel analytical and biomedical applications. Chem. Sci., 2011, 2(6), 1003.
[12]
Gopinath, S.C.B.; Kumar, P.K.R. Aptamers that bind to the hemagglutinin of the recent pandemic influenza virus H1N1 and efficiently inhibit agglutination. Acta Biomater., 2013, 9(11), 8932-8941.
[13]
Song, K.M.; Jeong, E.; Jeon, W.; Cho, M.; Ban, C. Aptasensor for ampicillin using gold nanoparticle-based dual fluorescence-colorimetric methods. Anal. Bioanal. Chem., 2012, 402(6), 2153-2161.
[14]
Green, N.M. Spectrophotometric determination of avidin and biotin. Methods Enzymol., 1970, 18, 418-424.
[15]
Gopalakrishnan, L.; Doriya, K.; Kumar, D.S. Moringa oleifera: A review on nutritive importance and its medicinal application. Food Sci. Hum. Wellness, 2016, 5(2), 49-56.
[16]
Chivers, C.E.; Koner, A.L.; Lowe, E.D.; Howarth, M. How the biotin-streptavidin interaction was made even stronger: Investigation via crystallography and a chimaeric tetramer. Biochem. J., 2011, 435(1), 55-63.
[17]
Steinmetz, N.F. Viral nanoparticles in drug delivery and imaging. Mol. Pharm., 2013, 10(1), 1-2.
[18]
Ivona, S.; Vera, H.; Marcela, L.; Jan, P.; Denisa, M.; Karel, K.; Frantisek, F. Preparation, physico-chemical properties and application of nanoparticles in bioanalyses. In: Conference Proceedings Nanocon 2009, 2009.
[19]
Letchumanan, I.; Gopinath, S.C.B.; Md Arshad, M.K.; Anbu, P.; Lakshmipriya, T. Gold nano-urchin integrated label-free amperometric aptasensing human blood clotting factor IX: A prognosticative approach for “Royal Disease”. Biosens. Bioelectron., 2019, 131, 128-135.
[20]
Letchumanan, I.; Md Arshad, M.K.; Balakrishnan, S.R.; Gopinath, S.C.B. Gold-nanorod enhances dielectric voltammetry detection of C-reactive protein: A predictive strategy for cardiac failure. Biosens. Bioelectron., 2019, 130, 40-47.
[21]
Pandian, K.; Mohanasoundari, D. Rudra showdri, N.P.; Kalaiyarasi, J.; Gopinath, S.C.B. Voltammetric estimation of caffeic acid on glassy carbon electrode modified chitosan-protected nanohybrid composed of carbon black and reduced graphene oxide. Mikrochim. Acta, 2019, 186, 54.
[22]
Sudarvizhi, A.; Pandian, K.; Oluwafemi, O.S.; Gopinath, S.C.B. Amperometry detection of nitrate in food samples using tetrasulfonated copper phthalocyanine modified glassy carbon electrode. Sens. Actuators B Chem., 2018, 272, 151-159.
[23]
Ranjani, B.; Kalaiyarasi, J.; Pavithra, L.; Devasena, T.; Pandian, K.; Gopinath, S.C.B. Amperometric determination of nitrite using natural fibers as template for titanium dioxide nanotubes with immobilized hemin as electron transfer mediator. Mikrochim. Acta, 2018, 185, 194.
[24]
Perumal, V.; Saheed, M.S.M.; Mohamed, N.M.; Saheed, M.S.M.; Murthe, S.S.; Gopinath, S.C.B.; Chiu, J.M. Gold nanorod embedded novel 3D graphene nanocomposite for selective bio-capture in rapid detection of Mycobacterium tuberculosis. Biosens. Bioelectron., 2018, 116, 116-122.

Rights & Permissions Print Cite
Article Metrics
14
3
© 2024 Bentham Science Publishers | Privacy Policy